Piltdown Hoax

1. Piltdown Hoax was an archaeological site in England where in the year 1908 and 1912 human, ape and other mammal fossils were found together. And In 1913 at a nearby site diggers appeared to have stumbled upon an ape's jaw with a canine tooth worn down like a human's. Being surprised at the rare fine diggers decided to hand over the remains to an amateur archeologist named Charles Dawson who lived in the town of Piltdown. The general community of British Paleoanthropologists came to accept the idea that the fossil remains belonged to a single creature that had had a human cranium and an ape's jaw.But In 1953 the Piltdown 'man' was exposed as a forgery by Kenith Oakley with the help of modern techniques.This sparked an uproar in the scientific community. The skull was in fact modern and the teeth on the ape's jaw had been filed down. Piltdown hoax confirmed A hypotheses about our early ancestors that were in fact wrong specifically that the brain case developed before the jaw. with this being confirmed it through researchers off track for decades. Every man who was involved in the hoax knowingly or unknowingly was shamed and embarrassed. 

2. the Piltdown hoax is taken to be proof that science and scientist are more or less not always right. It proves that scientist can be wrong and have made the mistake on trusting other scientist. the Piltdown forgery demonstrates the fallibility of scientific knowledge. It demonstrates how theories and facts are related in science. Most of the fault lies mostly on the museum which housed the remains of the finding .The hoax is another instance of desired fame for leading a scholar into dishonesty. Far from being a triumph of Science the hoax points to common and dangerous faults. The hoax succeeded in large part because of the careless nature of the testing applied to it; careful examination using the methods available at the time would have immediately revealed it as a hoax. This failure to adiquetly examine the fossils went unmarked and unnoticed at the time in large part because the hoax admirably satisfied the theoretical expectations of the time. 

3. scientists used a fluorine solution to reveal the date of the fossil which gave it a date backing it to more than 100,000 years. once a date was reached, they decided to do more tests using large scaling dating. it accurately dated to 100 years or more making the skull younger than what it was originally said to be. This analysis proved that the skull was in fact stained and the teeth had been filled to make it seem like human which was shown using a microscope. This alone showed positive aspects and new innovative tools such as the microscope to help determine the hoax. 

4. it will not be possible to remove the human factor in science, mainly because it is vital for the development of mankind to go through trial and error to improve on our own and learn new ways of understanding new findings. Errors like this have helped science in determining hypothesis, research or anything scientific for that matter by proving them right or wrong. And without the human factor computers or intelligent AI wouldn't be able to come up with such bold theories like “the big bang” or “evolution” its the human touch that has helped our advancement as a society.

5. Life lesson? well people are liars for one! and that having evidence to prove something means you should question it no matter how wrong or right you may be after all humans make mistakes. And as a future career in law enforcement ill have to do my own research to determine the sources of a crime no matter if it comes from a criminal or a person with a phd.

1. A. Many whale and bat species share common evolutionary ancestors,(the two are not linked) and have homologous traits. Homologous traits are traits that are similar to one another due to shared ancestry. As species adapt to their environments and evolve over time, these traits may change in appearance and in function, but ultimately they still share the structure, genetics, or embryonic structure of their common ancestor.       

1. B. Whales do, of course, share a common ancestor but this common ancestor is not the reason that whales have their aquatic adaptations. The ancestors of whales first evolved into a terrestrial life, then evolved back into the water, much later in life. And as for the bat  species the trait was used primary for flight the differences between these two species traits is the analogous structures traits similar in origin but dont have a common ancestor. 

       C. Welling carnivore called Pakicetus was the common ancestor of the whale the ear bones and teeth of Pakicetus are similar to those of modern whales and as for the bats they are closely related to lemur due to their arms were great for grappling just like bats hanging upside down.

                

1. The human and the ape both species have upper and lower limbs and are made up of similar bones and muscles the general function is the same even if the specifics vary slightly. humans have shorter arms than legs while as apes have longer arms than legs. 

1. Apes do more walking than climbing but still have the same structure. both ape and man have similar bone structure as well as muscle for example Humans can walk and run longer distances than apes whereas apes can climb better without struggle. 

C. Australopithecus afarensis is the common ancestor of both ape and manThe shoulder of Australopithecus afarensis was more like an African ape than a human, and  closer to human’s than to an ape’s.This positioning is consistent with evidence for increasingly sophisticated tool use in Australopithecus. C.Australopithecus

Say What Now....?

Translate this DNA strand to mRNA and decode it to figure out the sentence 

TAGTTCGCGTACCACTAAGAGTCACTTACGTGCAAGCCTTGGTGAATCCCCGTCAGC 

Alfred Russel Wallace 
i believe was one of the major contributors to darwin theory of evolution in fact he should have been a co founder of the theory, during a trip to the tropics, exposure to malaria was when  Wallace started to come up with the idea of natural selection. He sent his manuscript to Darwin, who puts together a set of notes to be presented alongside Wallace's and darwin hearing at the linean society.Darwin and Wallace found their inspiration in economics from an English reverend  named thomas malthus. He  published a book in 1797 called essay of principle population in which he warned his fellow countrymen  that most policies designed to help the poor were doomed because of the rapid pressure of population growth. A nation could easily double its population in a few decades, leading to famine and misery for all classes of life mainly the poor.

When Darwin and Wallace read Malthus, they realized that to both of them animals and plants should also be experiencing the same population pressure. It should take very little time for the world to be submerged or at least infested  with beetles or earthworms. But the world is not , or any other species for that matter mainly because they cannot reproduce to their full potential. Many die before they become adults. They are vulnerable to droughts and cold winters and other environmental pressures. And their food supply, like that of a nation, is not infinite. Individuals must compete for what little food there is. 

https://www.theguardian.com/science/2013/jan/20/alfred-russel-wallace-forgotten-man-evolution

Could Darwin have developed his theory of natural selection without the influence and ideas of this individual?

yes he could have developed the theories without the help of alfred but what helped darwin the most was that two scientific studies done in separate locations at the time arriving in the same conclusion to back darwin ideas.



How did the attitude of the church affect Darwin and his decision to publish his theory?
Having copious amounts of influence at the time the catholic church was not to fond of the theories of darwin or another evolution theorist at the time. Many believed it was blasphemy to speak of such theories and in doing so went against god.

I you were stranded on a desert island what two items would you take ???? 

What items would i take lets see....??  Well for one i would take a solar powered radio/gps mainly to notify help and let them know my exact coordinates in case i need to be rescued and my second item would be a Gary Foreman grill in case i get hungry and decide to do a bit of grilling while i wait for search and rescue.